getFasta
Retrieves a sequence from an opened multifasta file.
getFasta(opened_file, sequence_name)
opened_filean opened multifasta file eg. opened_file=open("/path/to/file.fa",'r+')sequence_namethe name of the sequence to be retrieved eg. for '>2 dna:chromosome chromosome:GRCm38:2:1:182113224:1 REF' use: sequence_name=str(2)returnsa string with the sequence of interest
>>> import AGEpy as age
>>> fafile="/path/to/GRCm38.dna.primary_assembly.fa"
>>> with open(fafile, "r") as fastafile:
... chr2=age.getFasta(fastafile, "2")
>>> print len(chr2)
182113224
>>> print chr2[82113224:82113284]
AGGGTGAATGATGTTTCTGGTACAGTGTACCAGTAAACCTAGCAGTAGGAGCATCAGTAT
writeFasta
Writes a fasta sequence into a file.
writeFasta(sequence, sequence_name, output_file)
sequencea string with the sequence to be writtensequence_namename of the the fasta sequenceoutput_file/path/to/file.fa to be writtenreturnsnothing
>>> import AGEpy as age
>>> print len(chr2)
182113224
>>> print chr2[82113224:82113284]
AGGGTGAATGATGTTTCTGGTACAGTGTACCAGTAAACCTAGCAGTAGGAGCATCAGTAT
>>> age.writeFasta(chr2,"2 my version of this sequence","/path/to/out/file.fa")
rewriteFasta
Rewrites a specific sequence in a multifasta file while keeping the sequence header.
rewriteFasta(sequence, sequence_name, fasta_in, fasta_out)
sequencea string with the sequence to be writtensequence_namethe name of the sequence to be retrieved eg. for '>2 dna:chromosome chromosome:GRCm38:2:1:182113224:1 REF' use: sequence_name=str(2)fasta_in/path/to/original.fafasta_out/path/to/destination.fareturnsnothing
>>> import AGEpy as age
>>> fafile="/path/to/GRCm38.dna.primary_assembly.fa"
>>> with open(fafile, "r") as fastafile:
... chr2=age.getFasta(fastafile, "2")
>>> chr2=chr2.strip("N")
>>> age.rewriteFasta(chr2, "2", fafile, "/path/to/modified/file.fa")