getFasta

Retrieves a sequence from an opened multifasta file.

getFasta(opened_file, sequence_name)

• opened_file an opened multifasta file eg. opened_file=open("/path/to/file.fa",'r+')
• sequence_name the name of the sequence to be retrieved eg. for '>2 dna:chromosome chromosome:GRCm38:2:1:182113224:1 REF' use: sequence_name=str(2)
• returns a string with the sequence of interest

>>> import AGEpy as age
>>> fafile="/path/to/GRCm38.dna.primary_assembly.fa"
>>> with open(fafile, "r") as fastafile:
...     chr2=age.getFasta(fastafile, "2")
>>> print len(chr2)

182113224

>>> print chr2[82113224:82113284]

AGGGTGAATGATGTTTCTGGTACAGTGTACCAGTAAACCTAGCAGTAGGAGCATCAGTAT

---

writeFasta

Writes a fasta sequence into a file.

writeFasta(sequence, sequence_name, output_file)

• sequence a string with the sequence to be written
• sequence_name name of the the fasta sequence
• output_file /path/to/file.fa to be written
• returns nothing

>>> import AGEpy as age
>>> print len(chr2)

182113224

>>> print chr2[82113224:82113284]

AGGGTGAATGATGTTTCTGGTACAGTGTACCAGTAAACCTAGCAGTAGGAGCATCAGTAT

>>> age.writeFasta(chr2,"2 my version of this sequence","/path/to/out/file.fa")

---

rewriteFasta

Rewrites a specific sequence in a multifasta file while keeping the sequence header.

rewriteFasta(sequence, sequence_name, fasta_in, fasta_out)

• sequence a string with the sequence to be written
• sequence_name the name of the sequence to be retrieved eg. for '>2 dna:chromosome chromosome:GRCm38:2:1:182113224:1 REF' use: sequence_name=str(2)
• fasta_in /path/to/original.fa
• fasta_out /path/to/destination.fa
• returns nothing

>>> import AGEpy as age
>>> fafile="/path/to/GRCm38.dna.primary_assembly.fa"
>>> with open(fafile, "r") as fastafile:
...     chr2=age.getFasta(fastafile, "2")
>>> chr2=chr2.strip("N")
>>> age.rewriteFasta(chr2, "2", fafile, "/path/to/modified/file.fa")

---